lunes, 17 de diciembre de 2018

Ejercicios traducción y proteínas


Los stops en el ARNm sirven para cesar la traducción del ARN a proteínas

PREGUNTA: Rodea en el diagrama los enlaces peptídicos. ¿De qué aminoácidos se trata? Propiedades químicas de los aminoácidos implicados


PREGUNTA: La siguiente proteína ¿Es una estructura terciaria o cuaternaria? ¿Por qué? ¿Cuántos tipos distintos de estructuras secundarias tiene? nómbralas 
 
PREGUNTA: La siguiente proteína ¿Puede tener enlaces disulfuro? ¿Por qué?

 

PREGUNTA: Dibuja un tripéptido constituído de histidina, triptófano e isoleucina
PREGUNTA: Di si es falso o verdadero: a) Un D-aminoácido desvía la luz polarizada hacia la derecha. b)Todos los aminoácidos proteicos presentan la forma L. c) tienen al menos un carbono asimétrico. d) Presentan isomería óptica.
PREGUNTA: ¿Qué técnicas utilizarías para resolver los siguientes problemas de proteínas? a) Determinar el peso molecular de una proteína b) Determinar si una enzima está formada por más de una cadena polipeptídica c) Determinar la estructura tridimensional de una proteína d) Determinar el proteoma de una muestra
PREGUNTA: Sabemos que un gen de 4365 nt codifica una proteína de 1454 aminoácidos. Si esa proteína tiene un peso estimado de 159.94 kDa. Un aminoácido promedio pesa 0.11 KDa. ¿Qué pesos tendrán los fragmentos resultantes si esta proteína se digiere por la proteasa tripsina, la cual tiene en el gen una secuencia de corte CGAGTTTATGCT entre los nucleótidos 3000 y 3012?. Sabemos que la tripsina corta los péptidos entre la arginina y la valina:














Sitúa las bandas correspondientes a los fragmentos

PREGUNTA: Rodea en el diagrama los enlaces peptídicos.
 
Solución:

PREGUNTA: Rodea en el diagrama los enlaces peptídicos.¿De qué aminoácidos se trata?
 PREGUNTA: La siguiente proteína ¿Puede tener enlaces disulfuro? ¿Por qué?
PREGUNTA: El aminoácido abajo ¿Es hidrofóbico, hidrofílico? ¿Por qué?
PREGUNTA: El siguiente polipéptico Metionina-fenilalanina-triptófano-prolina-isoleucina-valina-alanina ¿Es hidrofóbico, hidrofílico? ¿Por qué?
PREGUNTA: Define proteasa. ¿Se puede considerar una proteasa como un ribozima?

PREGUNTA: Encuentra un ORF (marco abierto de lectura) si lo hubiere, transcríbelo a mRNA y tradúcelo a su secuencia de aminoácidos

5’ ATGTTATTGTCGTATGCGACGTACATGTTTCATGCCCGT 3’


PREGUNTA: Señala las frases falsas. Estructura de proteínas:
a. Las proteínas monoméricas no tienen estructura secundaria.
b. Una proteína monomérica puede tener más de un dominio en su estructura terciaria.
c. Los puentes disulfuro pueden ser importantes en el mantenimiento de la estructura terciaria y cuaternaria de las proteínas.
d. La estructura terciaria de una proteína puede presentar fragmentos con estructuras cuaternarias distintas.

PREGUNTA: La proteína (abajo) ¿Se puede considerar un estructura cuaternaria? ¿Cuántos tipos y cómo se llaman distintos de estructura secundaria tiene?
PREGUNTA: Existen diferencias entre los ribosomas de eubacterias y los de las células eucariotas? ¿Qué implicaciones médicas tiene?

PREGUNTA: ¿Qué tipo de estructura tiene la proteína (arriba)?

PREGUNTA: La estructura de la proteína (abajo), nómbrala y define el tipo de enlaces que originan esa estructura

PREGUNTA: Tengo un gen de 666 nt. Este gen codifica para una proteína de ……… aa. ¿Cuál será de peso molecular en kDa de esa proteína?...… Por ejemplo: No puede saberse exactamente la CANTIDAD de aminoácidos de una proteína conociendo solo su peso. Los aminoácidos tienen pesos variables. Lo que se hace, es dividir el peso total de la proteína, por un peso PROMEDIO de los aminoácidos. Ese peso promedio es cercano a los 110 Da.

PREGUNTA: En el gen de 666 nt podemos observar que existen dos secuencias CGAGTTTATGCT, en las posiciones 222-234 y 531-543 del gen. Esta secuencia codifica para Arg-val-Tyr-Ala. Sabemos que: 







 




Digerimos nuestra proteína con quimiotripsina y la corremos en un gel de SDS-PAGE. ¿En qué posición aparecerán las bandas?
PREGUNTA: Localiza un enlace peptídico y di si es trans o cis
PREGUNTA: Nombra las siguientes interacciones de esta estructura terciaria
PREGUNTA: Con qué aminoácidos se podrían formar, si es que se pueden formar, puentes disulfuro intracatenarios:

Ala-met-gly-asp-val-pro-cys-pro-trp-val-met-glu-phe-cys-glu-met-ala-ile-lys

PREGUNTA: Responder si las siguientes afirmaciones sobre los aminoácidos (si exceptuamos a la glicina) son VERDADERAS o FALSAS: a) Los aminoácidos constituyentes de las proteínas tienen formas L y D b) Los aminoácidos constituyentes de las proteínas tienen sólo formas D c) Los aminoácidos tienen el grupo R unidos al carbono a d) Los aminoácidos tienen entre el grupo carboxilo y el grupo amino tres carbonos: a, b, c
PREGUNTA: Dada la siguiente estructura proteica

Decir si las siguientes afirmaciones son verdaderas o falsas: a) Es una estructura proteica cuaternaria b) Es una estructura primaria c) Es una proteína que contiene dos hélices alfa d) Es una estructura compuesta de varias secuencias primarias e) Es una proteína con estructura terciaria
PREGUNTA: Los aminoácidos A, B, C, D y E  correspondientes al ARNm 5'AUG  AGC GUU UAC UGC 3' ¿De qué aminoácidos se trata? ¿Qué tipo de enlace une a estos aminoácidos? ¿Cuándo se produce el enlace entre dos aminoácidos se libera alguna molécula concomitantemente (al mismo tiempo)? ¿Si se sustituye la adenina del triplete de inicio, AUG por UUG ¿Cuál sería el aminoácido resultante? Ver tabla

PREGUNTA: Los aminoácidos A, B, C, D y E ¿De qué aminoácidos se trata?

PREGUNTA: ¿Qué técnicas utilizarías para resolver los siguientes problemas de proteínas? a) Determinar el peso molecular de una proteína b) Determinar si una enzima está formada por más de una cadena polipeptídica c) Determinar la estructura tridimensional de una proteína d) Determinar el proteoma de una muestra

PREGUNTA: Sabemos que un gen de 2367 nt codifica una proteína de 788 aminoácidos. Si esa proteína tiene un peso estimado de 86.68 kDa. ¿Qué pesos tendrán los fragmentos resultantes si esta proteína se digiere por la proteasa tripsina (corta entre la arginina y la valina) la cual tiene en el gen una secuencia de corte CGAGTTTATGCT entre los nucleótidos 666 y 678?

Sitúa las bandas correspondientes a los fragmentos

PREGUNTA: La siguiente estructura a) ¿De que tipo de estructura proteica se trata? ¿Podrías escribir la direccionalidad de cada uno de los polipéptidos? ¿Por qué fuerzas están unidos estos polipéptidos? ¿Sitúa algún enlace peptídico y dí si es cis o trans?

PREGUNTA: Rodea en el diagrama los enlaces peptídicos. ¿De qué aminoácidos se trata?
PREGUNTA: ¿Por qué el primer perfil de Maldi Tof realizado con bacterias del género Listeria es tan parecido entre si y el segundo perfil, de bacterias de géneros diferentes muestra distintos picos?


PREGUNTA: El siguiente polipéptico Metionina-fenilalanina-triptófano-prolina-isoleucina-valina-alanina ¿Es hidrofóbico, hidrofílico? ¿Por qué?

PREGUNTA: ¿Qué técnicas utilizarías para resolver los siguientes problemas de proteínas? a) Determinar el peso molecular de una proteína b) Determinar si una enzima está formada por más de una cadena polipeptídica c) Determinar la estructura tridimensional de una proteína d) Determinar el proteoma de una muestra

PREGUNTA: Utilizando la tabla de aminoácidos, dí cuáles son los grupos funcionales de los grupo R de los aminoácidos siguientes: serina, asparragina, tirosina,

Solución: serina grupo alcohol; asparragina amida; tirosina fenol; metionina sulfuro; glutamato sal de ácido carboxílico.

Ejercicios transcripción ARN


PREGUNTA: Si el ARNm tiene su extremo 5' como aparece en el gráfico ¿Qué extremo será el ADN que tiene una interrogación?
PREGUNTA: El extremo del ADN que tiene el interrogante ¿Es 5'o 3'? ¿Por qué?


PREGUNTA: Si parte de la secuencia del ARNm que será utilizado para sintetizar una proteína es:
5’ AUG CCG ACG GAA 3’

¿Cuál debe ser la secuencia del molde de ADN que le dio origen?

a) 5’UAC GGC UGC CUU 3’
b) 5’TAC GGC TGC CTT 3’
c) 3’ UAC GGC UGC CUU 5’
d) 3’ATC GGC AGC CAA 5’
e) 3’TAC GGC TGC CTT 5’


PREGUNTA: Señala aquellas afirmaciones que consideres ciertas sobre la ARNpolimerasa

a) La ARNpol polimeriza de 5’a 3’ b) La ARNpol sintetiza una cadena de ARN que queda unida al ADN molde por puentes de hidrógeno c) El factor sigma de la ARNpol de los eucariotas sirve para reconocer la secuencia iniciadora, es decir, el punto a partir del cual se empieza a transcribir el ARN
d) El factor sigma de la ARNpol sirve para reconocer la secuencia iniciadora, una vez que la transcripción ha empezado ya no se necesita el factor sigma y se libera de la ARNpol e) La secuencia iniciadora de la transcripción a la que se une la ARNpol es rica en G y C f) En procariotas la terminación de la secuencia de ARNm puede ser por secuencias palindrómicas ricas en G y C o por la secuencia RUT dependiente de Rho g) Las ARNpol son, en las procariotas, de tres tipos ARNpol I, ARNpol II y ARNpol III h) En procariotas la transcripción ocurre en el núcleo i) La caperuza de metil-guanosina y la cola de poliAs protegen al ARNm en eucariotas de ser degradado por las ARNasas del citoplasma j) La cola de poliA es fundamental para que la ARNpol se una al ADN que va a transcribir

a) V b) F c) F d) V e) F f) V g) F h) F i) V j) F


PREGUNTA: la caperuza de metil-guanosina o también caperuza 5', también denominada cap-5' o casquete, es un nucleótido alterado situado en el extremo 5′ de algunos transcritos primarios de eucariotas, como el precursor de ARN mensajero (ARNm). Este proceso, conocido como capping está altamente regulado y es vital en la creación de ARNm estables y maduros, capaces de ser traducidos durante la síntesis de proteínas. ¿Por qué el ARNm mitocondrialy el de cloroplastos ​ no tienen caperuza?

PREGUNTA: a) La ARNpol funciona como una helicasa separando las dos hebras de ADN para iniciar las transcripción b) La ARNpol sintetiza de 3’a 5’ c) La ARNpol lee el ADN de la cadena molde de 3’a 5’, es decir, al contrario que su actividad de polimerización que va de 5’a 3’ d) El ARN sintetizado por la ARNpol no se queda unido al ADN e) Cuando la ARNpol de procariotas llega a su secuencia terminadora (formadora de horquilla o terminación Rho) se separa del ADN y éste se vuelve a juntar entre si para formar una doble hebra de ADN


a) V b) F c) V d) V e) V


PREGUNTA: ¿Cómo puede la ARNpol formar ARNm con uracilo si el ADN molde tiene timina?

Solución: Cuando hay que fabricar DNA (replicación) trabaja la DNA polimerasa, que solo toma desoxirribonucleótidos (A, T, G, C).
Cuando hay que fabricar RNA (transcripción) trabaja la RNA polimerasa, que solo toma ribonucleótidos (A U G C).
A C G pueden ser tanto ribo como desoxiribonucleótidos, T solo es desoxi, y U solo ribo.

Conclusión:
Tanto T como U pueden unirse a A, pero T solo cuando se construye DNA y U solo cuando se construye RNA. T y U son equivalentes, ambos se unen a la Adenina formando dos puentes de hidrógeno.


PREGUNTA: Dada la secuencia de ADN bicatenario :

3´ - T G C C G T T A C C T A T C T G TG C G A G A G C G A T C A A T C T G C 5´

5´ - A C G G C A AT G G A T A G A C A C G C T C T C G C T A G T T A G A C G 3´

Indicar la secuencia de bases del correspondiente ARNm

Deducir la secuencia de aminoácidos correspondiente .

Puedes consultar la tabla de ADN/Aminoácidos AQUÍ

PREGUNTA: ¿Por qué utilizamos la tabla ADN/Aminoácidos y no la tabla ARN/Aminoácidos en genética?

PREGUNTA: ¿Dónde se situará la ARNpol en A o en B?

PREGUNTA: ¿Puede la ARN polimerasa actuar en el citoplasma? Razona tu respuesta

PREGUNTA ¿Por qué existen 3 ARN polimerasas en la célula eucariota?

 PREGUNTA: La gráfica (arriba) pertenece a una transcripción eucariota o procariota ¿Por qué? 

¿Qué ocurriría si eliminamos de un gen la caja TATAA?

¿Qué ocurriría si eliminamos el RBS (Ribosomal binding site) de un gen?

Cita tres diferencias entre la transcripción en procariotas y en eucariotas

¿Qué diferencias existen entre intrones y exones?

PREGUNTA: Si (5’) CGCUAUAGCG (3’) es el transcrito de RNA ¿Cuál será la cadena molde y cuál la codificadora?

Solución:   3´ GCGATA TCGC 5´ADN molde
                  5´ CGCUAUAGCG 3´ARN mensajero

                  5´ CGCTATAGCG 3´ ADN codificante

PREGUNTA: ¿Qué le ocurriría a un ARNm eucariótico si careciese de CAP y de cola poliA?


Solución: La caperuza 5' tiene varias funciones siendo las principales regular la exportación desde el núcleo al citoplasma y proteger al ARNm de la degradación en el citoplasma por las exonucleasas ARNasas. La cola de poliA tiene también las mismas funciones que la caperuza 5', esto es, regular la exportación al núcleo y proteger al ARNm de la degradación por ARNasas. La diferencia es que las ARNasas si pueden degradar la cola de poliA. De esta manera garantizan que los ARNm no permanezcan sine die en el citoplasma. Esto es quizás lo más importante del proceso ya que al permitir que una parte del ARNm se pueda degradar: la cola de poli A, la célula eucariota puede tener distintos conjuntos de ARNm en el citoplasma para poder ser traducidos a distintas horas del día o dependiendo de las distintas necesidades a las que se vean expuestas. Por ese motivo, esta respuesta no tiene el 2 y sólo un 1.5, porque dice que la caperuza y el poliA dan protección para que no se afecten los nucleótidos. El sistema cap-poliA es un sistema dinámico que alarga la vida de los ARNm pero permitiendo que las ARNasas degraden el poliA.

PREGUNTA: ¿Por qué después del codón de stop ya no hay proteína? ¿Por qué el codon de stop no codifica aminoácido?


Cuantificación de proteínas

Esta práctica de laboratorio comprende la elaboración de diluciones seriadas, a partir de una solución madre de BSA para construir una curva estándar de cuantificación de proteínas; la medición de la cantidad de proteínas de los extractos por el método de Bradford mediante espectrofotometría; y el cálculo de su concentración.

Aparatos, equipos e instrumentos                           Cantidad              Requisitos técnicos
Espectrofotómetro                                                            1                          calibrado
Balanza analítica                                                              1                          calibrada
Juego de Micropipetas (10, 100 y 1000 ul)                      5                           calibradas

Materiales
                                                                Cantidad              Especificaciones
Celdas de espectrofotómetro                                          25          
Pipetas Pasteur de 1,5mL                                               10 unidades      
Guantes de látex                                                             20 pares              Talla S, M y L
Guardianes                                                                       3 unidades        
Puntas de micropipetas                                                   2 rack por cada una       
Tubos eppendorf de 1,5ml                                             12          
Cajas con hielo                                                                 5                        5x5cm aproximadamente
Papel aluminio  Medio rollo        

Reactivos                                                                  Cantidad              Especificaciones
PBS                                                                                  5ml       
BSA                                                                                 5mg      
Reactivo de Braford                                                        4 ml      
Agua destilada                                                               20 ml    
Muestra de proteínas extraídas 10ul cada grupo 
             
Descripción del procedimiento

Curva estándar con BSA:
• Para realizar la curva del estándar preparar por duplicado 5 diluciones medias en PBS de la proteína estandar (BSA) entre 20 mg/ml a 0 mg/ml. También incorporar a la curva el valor "blanco" (PBS solo).
• Realizar 2 diluciones seriadas de las muestras

Cuantificación de Proteínas:
• Colocar 200 μl del reactivo de Bradford en cada celda del espectrofotómetro que se va a utilizar.
• Incubar a temperatura ambiente por un mínimo de 5 minutos. Pasamos nuestras muestras a las celdas de espectrofotómetro.
Espectrofotómetro y celda de espectrofotómetro (en mis dedos). El punto rojo se ha dibujado para mostrar por donde atravesará la muestra el haz de luz
 • Medir la absorbancia a 595 nm en el espectrofotómetro
En la espectrometría de absorción, se compara la intensidad de un haz de luz medida antes y después de la interacción con una muestra. La absorbancia mide la cantidad de luz que ha "absorbido" las proteínas en la disolución. Si no tenemos proteínas la absorbancia será cero. De hecho podemos utilizar el tubo sin proteínas como blanco en el espectrofotómetro. La solución más concentrada de proteínas deberá tener una absorbancia sobre 0.9. Valores más altos de absorbancia dejan de tener una relación lineal con la concentración de proteínas.
• Con los valores obtenidos, construir la curva de calibración y calcular la concentración de nuestras muestras problema. Para ello podemos calcular la ecuación de una recta con excell

PREGUNTA¿Qué significa límite de linealidad en una curva de calibrado? ¿Qué significa límite detectable en un experimento de espectrofotometría?
Fuente
PREGUNTA: ¿Qué podemos hacer si la concentración de nuestra muestra excede el límite de linealidad?

PREGUNTA: ¿Qué función tiene el reactivo de Bradford en este experimento?

PREGUNTA: ¿Por qué es mejor hacer una dilución seriada a simplemente tomar los microlitros de una solución stock concentrada y diluirlos?

PREGUNTA: La siguiente curva de calibrado está expresada por una ecuación A = mC + 0.058. ¿Cómo hacemos experimentalmente para reducir el valor 0.058 a cero?

PREGUNTA: Realiza la curva de calibrado con una dilución de BSA. La solución madre de BSA de la que partimos es de 200 mg/ml. El volumen final es de 1 ml. Para preparar la solución problema hemos cogido 25 ul del extracto proteico y le hemos añadido Bradford y PBS para llegar a un volumen final de 1 ml. Halla la media y extrapola la concentración de una muestra problema con una absorbancia de 0.6. 
PREGUNTA: Considerando que usted midió la absorbancia de cada una de las soluciones que preparó y construyó la siguiente curva, con su ecuación y valor de R . Calcule la concentración de proteínas de su muestra que presentó una absorbancia de 0.25nm

miércoles, 12 de diciembre de 2018

Y si baja la natalidad ¿Para qué tantos maestros?

Y si baja la natalidad ¿Para qué tantos maestros?

https://elpais.com/sociedad/2018/12/11/actualidad/1544552685_545152.html

Los árboles y las árbolas no os dejan ver el bosque y la bosca

 Frente a la inestabilidad, los partidos que prometen el "juntos seremos más fuertes", es decir, la lógica del rebaño, no cesarán de ganar votos. 
Los español@s quieren tener hijos pero la situación económica no se lo permite. Además, muchos hombres perciben que tener hijos no es buen negocio. La falta de políticas de redistribución de la riqueza, la corrupción, la robotización, la falta de ayudas a la natalidad... lo cierto y verdad es que  después de la crisis económica de 2008 muere más gente que nace en España, como se puede ver en la gráfica presentada por el Instituto Nacional de Estadística Español.
,
La caída de la natalidad y el cambio de estructura familiar provocará un tsunami social. No se podrán pagar las pensiones de jubilación ni muchos de los servicios a los que estamos acostumbrados.
Nos enfrentamos a un mundo nuevo. Ya nada será como antes. Se buscarán culpables y la primera víctima será el contrato social. Aunque ese contrato ya se empezó a romper y aquí muestro tres de esos ataques: diferencias en los tipos de contratos, la existencia de emigrantes alegales y las leyes de género. Desde la izquierda (y también desde alguna derecha) se propone un salario social. Un salario sólo al alcance de los nacionales. Grupos como Vox proponen expulsar a la inmigración ilegal. En un mundo en donde se mueren más de los que nacen los problemas sólo se arreglaran si se consiguen unas reglas en las que quepamos todos.

Contratos para ciudadanos de primera y de segunda

Los sindicatos han luchado muy justamente por la mejora de las condiciones laborales de los trabajadores a través de los convenios laborales. El problema ha sido cuando existen distintos tipos de contratos. Existe una fractura generacional entre personas mayores con contratos indefinidos y gente joven precaria, tan precaria, que son incapaces de soñar un mundo distinto. En mi experiencia, yo tenía un contrato por 5 años que se tenía que hacer fijo. No me podían hacer fijo porque estaba contratado por el Servicio Galego de Saude. Para entrar en plantilla tendrían que hacerme una oposición, como eso no era posible me daban la alternativa de contratarme como licenciado, siendo doctor, en un puesto de analista de riesgos laborables para desde allí hacer investigación con un contrato precario. ¿Es eso justo? no. Qué en mi hospital hubiese un tipo que tenía un trabajo que ya no era necesario, como es el de sacar fotocopias, en un momento en el que podemos sacar fotos con los celulares e imprimirlas si hiciese falta, con su oposición, al que no se puede echar... eso a nadie le parecía mal. Cuando un partido, como Ciudadanos, ofrece un contrato único, desde el mundo sindical se ve como un ataque a los mejoras laborales conseguidas ¿De quiénes? ¿De todos? A mi me hubiese beneficiado un contrato único porque me hubiese dado cabida en el sistema en igualdad de condiciones. Es la desigualdad la que rompe el contrato social y genera sentimientos mezquinos como: Las mejoras laborales o se consiguen para todos o para ninguno porque cuando estás en el lado malo de la balanza prefieres que todos estemos mal a que unos estemos bien y otros mal. Por ese motivo, una renta social para todos los nacionales seguirá siendo un parche al problema. Pagamos a los de dentro,expulsamos a los de fuera que quieren entrar en nuestro club exclusivo

La clase media se ha vuelto pobre y no es culpa de los emigrantes

Los emigrantes ilegales compiten con las personas de menor preparación en las naciones desarrolladas. Estas personas votan y votarán a aquellos que perciban que van a a arreglar sus problemas. Las personas de mayor formación no se verán afectados por la inmigración ilegal por eso condenan el racismo. Ellos son clase media porque todavía pueden consumir productos fabricados en países sin derechos laborales. Algún día dejarán inexorablemente de serlo cuando las clases medias se desplacen de países que antaño fueron industriales por los que ahora detentan este estatus. Los inmigrantes ilegales compiten con las personas menos preparadas en los países europeos y los países sin costos laborales se están llevando cada vez más los trabajos a sus países. Mientras tanto, vivimos la ficción de ser una clase media "low cost" comprando productos muy baratos que si no fuese por ese precio no nos podríamos costear.

Mi amigo Ernesto Carmena me dijo un día, y fue muy certero en su juicio, en mi opinión: "No es que no se pueda tener hijos, es que no quieren tener hijos de pobre". Evidenciaba de esta manera el hecho de que en España, esa España que nos quieren hacer creer que se vive muy bien, la clase media es pobre y no quiere creérselo. Podrían tener hijos de pobre, y pasarse los fines de semana en el parque, como ocurre acá, en el Ecuador, pero prefieren no enfrentarse a esa realidad comprando en sitios baratos como Decathlon, viajando en líneas "low cost" y tomando cañas en los bares.

Necesitamos emigrantes en España. Los necesitamos con papeles. Necesitamos comprar productos en países que tengan derechos laborales. Necesitamos que el contrato social abarque todo el planeta. Necesitamos una buena redistribución de la riqueza.

Leyes de género: cuando la justicia es como un péndulo y ahora toca del otro lado

En España el porcentaje de hombres que no desea tener hijos es mayor que el porcentaje de mujeres. Muchos hombres jóvenes perciben que la paternidad no es un buen negocio para ellos. A raiz del discurso de Vox en las elecciones andaluzas de diciembre 2018, atacando a las leyes de género, han sido muchos los comentaristas que han enfatizado sobre el hartazgo que suscitan las leyes de género. No voy aquí a abundar en ello. Sinceramente creo que las familias y las relaciones personales nunca más van a ser lo que eran. La biología nos premia con endorfinas que generamos al tener sexo. La química en el futuro nos proveerá de análogos de endorfinas porque la química tiene la tecnología y el proceso industrial hará que se abaraten. La computación y los mundos virtuales harán que el placer se pueda asociar a otro tipo de actividades en donde el humano interactuará con computadores y robots cada vez más adaptados a los gustos del consumidor. Sólo tendrán hijos los grupos religiosos fundamentalistas y aquellos que tengan el deseo de tener a quien dejar su fortuna. Luego estarán los que estén fuera del sistema.
La fragata construida en Ferrol y que se hundió estaba tripulada por un 80% de mujeres. Las mujeres son un 20% de las fuerzas armadas noruegas ¿Pudo tenerse más en cuenta en el proceso el sexo que la preparación?. Fuente
A esta señora le dieron un premio negativo, el Filoxera, pagado con dinero público, por mantener una postura crítica frente a las leyes de género.
 
El tono de la Sra. Carril es calmado y emotivo ¿Y los datos? Habría que analizarlos y ver si los está deformando, sin embargo, como ella dice, todos conocemos a amigos, compañeros de trabajo, primos... que están en la situación que describe. Hay una realidad social y sólo desde esta extrema derecha se le está dando voz

El discurso actual de la extrema derecha promete y no cumplirá integrar a muchos de los que se sienten excluidos

Vox con su discurso xenófobo antiemigrantes y contra las leyes de género están creando un discurso atractivo para parte de la población: no vas a tener un contrato de mierda porque todos los contratos serán iguales, no te va a quitar el trabajo un emigrante, no te van a quitar a los hijos por ser hombre. No es que Cataluña se vaya, es que desde Andalucía vamos a reconquistar España. Una idea integradora, aunque sea a la fuerza. Ciudadanos y Vox no pretenden crear un consenso y un contrato social. Lo van a romper, van a separar a la población en buenos y malos españoles. Luego los atacarán. Que no os quepa duda. Sin embargo, su discurso actual integra en el sistema a muchos que se sienten excluidos.

Hemos visto como las estadísticas nos muestran que en España se quiere tener hijos pero no se quiere tener hijos de pobre. Y no es por falta de riqueza. Galicia tiene 2.7 millones de habitantes, Quito tiene 2.5 millones. Siempre me sorprendo de la cantidad de industria que hay en Galicia comparada con la que se observa en los alrededores de Quito. ¿Cómo es posible que existan salarios tan bajos y una natalidad tan exigua? la solución es la poca redistribución de la riqueza, existencia de privilegios de clase, enchufismos (palancas) y clasismo financiado con dinero público como la educación concertada. Ciudadanos y Vox tienen políticas contrarias a la redistribución de la riqueza. Vox apoya la supresión del impuesto de sucesiones y eliminar el IRPF progresivo, es decir, que los que más ganan paguen más impuestos. Millonarios de los EEUU criticaron la bajada de impuestos anunciada por Trump porque en su opinión eso haría que el país dejase de ser una meritocracia al ser los ricos solamente ricos por herencia y no por su trabajo. Por lo tanto, estas políticas no van a dar los frutos que prometen.

Para acabar. Con la gráfica de caída de la natalidad y aumento de la mortalidad que hemos visto arriba del artículo nos situamos en un escenario nuevo. Estamos perdiendo población y no es a causa de una guerra. La población que se pierde son básicamente niños que no nacen. Mientras tanto, vivimos en un mundo diseñado con tasas de natalidad más altas. Las políticas que se discuten pertenecen a un mundo en donde los niños al crecer tenían más niños y ese escenario ya no es el nuestro. ¿Cómo crearemos un nuevo contrato social para este sociedad que ya no tiene la reproducción como horizonte?


Algunas noticias interesantes analizando el fenómeno del auge de la extrema derecha en Andalucía en las pasadas elecciones de diciembre 2018:

https://www.meneame.net/story/hagamos-autocritica-verdad
https://www.elmundo.es/opinion/2018/12/03/5c03e0b4fc6c83666c8b45d4.html
https://www.meneame.net/story/os-dieron-cula-pues-mal-suerto
https://www.meneame.net/story/critica-izquierda-actual-uno-izquierdas

El estudio no os hará libres

 
El sistema de notas es algo bien perverso. Aprobar, conseguir un título, no te garantiza nada. Las notas tienen ese tipo de perversión que se podía leer en la entrada de los campos de concentración: "El trabajo os hará libres". Trabajo iban a tener, eso si, la libertad era simplemente una zanahoria para tenerlos controlados. Estudia y tendrás un porvenir. Bueno, estudiar vas a estudiar, lo del porvenir ya se verá. Ahora bien, si traspasas la puerta del recinto académico debes de saber que existen unas reglas, que hay que conocer, para poder jugar a este juego. Las reglas están descritas en el sílabo y la rúbrica. El sílabo es como un contrato entre el alumno y el profesor. En él se dice cuanta materia y cómo se va a evaluar. En la rúbrica se explica qué es lo que tiene que aprender el alumno y cómo se le va a evaluar ese conocimiento.
"No entiendo que es lo que pasa. Yo entiendo bien sus clases y estudio, he asistido a las tutorías, pero eso no es lo que reflejan mis notas..." "La verdad es que no me siento nada bien con las notas que tengo..."
No merece la pena pedir la recuperación de notas si esa recuperación no está en el sílabo. Si un profesor hace exámenes de recuperación que no está en el sílabo está mandando un mensaje erroneo y  equivocado: "Hay reglas pero las reglas se pueden cambiar si yo quiero siempre que un alumno me ruegue mucho". Las reglas son un contrato social que todos debemos de respetar. Nos ponemos de acuerdo en esas reglas "a priori". Por supuesto, las reglas se pueden cambiar, pero tiene que ser de mutuo acuerdo, no en función de necesidades personales.
El sistema de notas académico es perverso y sádico. Un reflejo de los golpes reales que te dará más adelante la vida
Las notas no evalúan a la persona, sólo su desempeño en el sistema de reglas académico. Debemos transmitir esto al alumno. Si un alumno suspende es porque no ha estudiado, o porque debe de tomar menos asignaturas porque su capacidad de trabajo no está a la altura de lo que se exige. Si esto ocurre, no pasa nada por hacer una carrera de 5 años en 8.
Ojo con las calificaciones. Hay que ser muy muy muy despegado en este sentido. La mejor evaluación es en la que no se tiene en cuenta al alumno. Sólo ver el sílabo la rúbrica y actuar en consecuencia. Si no tenemos esto claro puede llegar a haber goce en poner las calificaciones finales y eso, sencillamente, no está bien.
Cuando digo que el estudio no os hará libres es porque la libertad no está en sacar una carrera o tener buenas notas, es algo que depende de lo nosotros queremos. Saber lo que uno quiere... una pregunta que solo la responden aquellas personas que son muy honradas con ellas mismas.

Estudia que llegarás lejos

Una de las consecuencias de la calificación profesional es tener que irte lejos de tu lugar de origen. Los centros industriales se concentran en pocas áreas en el planeta. Por ese motivo, muchos gallegos, ecuatorianos... tienen que emigrar a Alemania, Estados Unidos... es una consecuencia de adquirir habilidades que no vas a poder desarrollar en tu propio país.
¿Qué tal tu hijo, acabó la carrera? Donde va que la acabó, ya está en cuarto año de diáspora. Autor Davila.
Un trabajo realizado por tres investigadores del Banco de Italia concluye que, en Italia, y esto se puede extrapolar al resto del mundo, a mayor cualificación de la mano de obra en las zonas pobres del país, mayor volumen de emigración.

Niños envenenados por médicos altamente especializados

Anita Novinsky es una de las fundadoras del Laboratorio de Estudios sobre la Tolerancia de la Universidad de Sao Paulo. Como educadora también expresa sus dudas sobre el papel que ha cumplido la educación hasta el momento en la historia en su siguiente texto:

“Querido profesor:

Soy una sobreviviente de un Campo de Concentración. Mis ojos vieron lo que ningún ser humano debería testimoniar: Cámaras de gas construidas por ingenieros ilustres, niños envenenados por médicos altamente especializados. Recién nacidos asesinados por enfermeras diplomadas, mujeres y bebés quemados por personas formadas en escuelas, liceos y universidades.

Por eso, querido profesor, tengo serias dudas acerca de la educación, y le ruego: ayude a sus estudiantes a volverse humanos. Su esfuerzo, profesor, nunca debe producir monstruos eruditos y cultos, psicópatas y Eichmans educados. Leer y escribir son importantes solamente si están al servicio de hacer a nuestros jóvenes seres más humanos”.


Para saber más:

https://onlinelibrary.wiley.com/doi/abs/10.1111/pirs.12439

sábado, 8 de diciembre de 2018

Extracción de proteínas

 Ojo: necesitaremos llevar a la práctica 10 gramos de hígado

Obtendremos un extracto de proteínas a partir de muestras biológicas mediante métodos de lisis y precipitación en frío

Aparatos, equipos e instrumentos
Cantidad
Requisitos técnicos
Microcentrífuga refrigerada 1 Para tubos eppendorf 1,5ml
Centrífuga refrigerada 1 Para tubos falcon de 15ml
Micropipetas (1000 ul) 5 calibradas
Balanza analítica 1 calibrada
Refrigeradora 1


Materiales
Cantidad
Especificaciones
Mortero con vástago
5

Pipetas Pasteur de 1,5mL
10 unidades

Guantes de látex
20 pares
Talla S, M y L
Guardianes
3 unidades

Puntas de micropipetas de 1000uL
3 rack

Tubos eppendorf de 1,5ml
12

Tubos falcón de 15ml
12

Cajas con hielo
5
5x5cm aproximadamente
Reactivos
Cantidad
Especificaciones
PBS
20 ml
Frío: NaCl 137 mM, Fosfato 10 mM, KCl 2,7 mM, pH 7,4
Sulfato de amonio saturado
5 ml
Frío
Agua destilada
10 ml
Fría

Extracción de proteínas


1. Pesar 10g de muestra biológica (hígado o carne).
2. Colocar un trozo de tejido en el mortero sobre el hielo. Agregar 1500 μl PBS.
Homogeneizar con el vástago hasta disgregar el tejido.
De ser necesario agregar más PBS para seguir disgregando (anotar el volumen extra agregado)
Tomar el extracto líquido con micropipeta (utilizando p1000) evitando aspirar los trozos menos disgregados de tejido.
3. Centrifugar 15 minutos a 14.000 rpm a 4°C
4. Colocar el sobrenadante en un tubo de 1,5 ml y conservar en hielo.

*PBS (buffer fosfato salino): NaCl 137 mM, Fosfato 10 mM, KCl 2,7 mM, pH of 7,4


Precipitación con Sulfato de amonio

5. Realizar las diluciones de la solución saturada de SO4(NH4)2 indicadas a continuación:
% Solución saturada de Sulfato de amonio
0
70
30
100
Volumen de agua (ul)
500
150
350
-
Volumen de Sulfato de amonio saturado (ul)
-
350
150
500
6. Rotular en la tapa 4 tubos con el % de sulfato de amonio agregado y el Número de grupo de trabajo (ejemplo para el grupo 4: 30% G4) Agregar en cada uno 100 μl del extracto crudo de proteínas.
Agregar 100 μl de las diluciones de SO4(NH4)2 en le tubo correspondiente.
7. Agitar vigorosamente durante unos segundos
8. Centrifugar 10 minutos a 14.000 rpm.
9. Tomar los sobrenadantes obtenidos y pasar a un nuevo tubo con el mismo rótulo, y descartar el tubo con el pellet.
10. Conservar en hielo si se va a cuantificar y sino a -20°C.


PREGUNTAS DE REPASO:

1. ¿Por qué utilizamos sulfato amónico y no sal de cocina (NaCl)?
2. ¿Por qué el sulfato amónico ayuda a que las proteínas precipiten?
3. ¿Por qué se realiza todo el proceso de extracción de proteínas a 4°C?