jueves, 24 de noviembre de 2016

Las piedras incas de Quito

Los españoles tallaron las piedras incas para que pareciesen de factura europea. Detalle del zócalo sobre el que está construido el convento de San Francisco de Quito.

eta
Si observamos de cerca nos daremos cuenta que la talla no coincide con las piedras originales.

Base de la torre de la iglesia de la Merced. Se cree que estas piedras pertenecían a un templo prehispánico. Localización

Piedras irregulares, típicas de los muros inca imperial, de la base del palacio de Carondelet en la Plaza Grande de Quito











miércoles, 23 de noviembre de 2016

Subir al Rucu

El autor del blog con el Dr Ayalkibet, de la U. de Barcelona en la cumbre del Rucu Pichincha 4696 m. La cumbre más alta de Europa es el Montblanc de 4809 m.
En Quito tenemos la fortuna de tener alta montaña a la puerta de nuestra casa. Si tomas el teleférico a las 8 de la mañana puedes estar a las doce y media de nuevo en Quito para comerte un ceviche

¿QUÉ HACE FALTA PARA SUBIR AL RUCU?

Botas, si no tenéis botas el calzado más tuco que tengáis. Es importante que sea fuerte pero flexible porque vamos a andar 6 horas. No os preocupéis por el esfuerzo, he visto abuelitas en la cumbre, niños de seis años y a un gringo calzado con flip-flops de plástico. Vosotros sois de la sierra, estáis genéticamente adaptados a las alturas, yo, que he subido como 14 veces solo estoy aclimatado (Para la explicación adaptado-aclimatado podéis preguntarle a Esteban Ortiz que tiene un master en biología de altura y os explica).

Pantalón, puede ser cualquier cosa finita, no vaqueros porque si se mojan se adhieren a la pierna se enfrían y son pesados. Mallas de licra, pantalones de yoga...

Gorra para el sol, crema solar porque el sol ahí arriba pega fuerte. Gafas de sol, guantes porque puede empezar a soplar el viento.

Llevaremos tres capas: camiseta sintética tipo la de la foto, forro polar y un chubasquero para el viento-lluvia. Yo, además de esto siempre llevo una capa para la lluvia, cuesta solo 5 dólares, y en caso de lluvia fuerte es lo único que te protege de quedarte completamente empapado


Comida: algo de picar tipo chocolate, frutos secos. Un sanduche, una pieza de fruta. Agua entre un litro y tres litros. No se os ocurra llevar una sandía porque el exceso de peso en las subidas se paga.
Con Chelita, su hijo juan y Eduardo Herrera. El Rucu Pichincha al fondo
Con Hégira y Patty en agosto 2019

 La diferencia entre subir al Rucu y subir al Cotopaxi

Este es el equipo que hace falta para subir al Cotopaxi

jueves, 17 de noviembre de 2016

Ejercicio amplifica el gen



5' ACCTAGCCTTTCCAAATGCGCATTACAATATATAA 3'

1- Encuentra el gen en este fragmento de ADN. ATG comienzo y stop TAA; TAG o TGA.
2.- Tamaño del gen en nt (el stop cuenta)
3.- Tamaño en aminoácidos de la proteína codificada
4.- Diseña dos primers de 5 nt para amplificar por PCR este gen.

Solución: Una secuencia genética se escribe usualmente utilizando una de las dos hebras de ADN. La razón, ahorrar espacio, como la información de la otra hebra se extrae automáticamente porque es complementaria por ese motivo no se suele representar. Para hacer un ejercicio de PCR necesitamos escribirla.

5' ACCTAGCCTTTCCAAATGCGCATTACAATATATAA 3'
3' TGGATCGGAAAGGTTTACGCGTAATGTTATATATT 5' 

Ahora tenemos que buscar un ORF (Open reading frame en inglés) el ORF es la información del gen que se va a traducir a proteína. El ORF consta de un ATG, que es el inicio, lo mismo que en castellano sería la primera letra, siempre en mayúscula, de una frase, y un stop, que sería el punto al final de la frase si en vez de código genético estuviésemos trabajando con frases en castellano.


5' ACCTAGCCTTTCCAAATG/CGC/ATT/ACA/ATA/TAT/AA 3'

Primero situamos el ATG y de 5' a 3' empezamos a buscar triplete a triplete un stop. ¿No hay stop? entonces no hay un ORF en la hebra de arriba. Vamos a buscarla en la de abajo.

En la hebra de abajo tenemos que leer de 5' a 3' también, pero OJO hay que leer como los árabes, de derecha a izquierda

3' TGGAT/CGG/AAA/GGT/TTA/CGC/GTAATGTTATATATT 5'

En la hebra de abajo tenemos un ORF. Se trata de un gen (tamaño escolar, en la realidad los genes suelen ser mucho más grandes) de 21 nucleótidos que codifica para una proteína de 6 aminoácidos.

Ahora vamos a amplificar este gen mediante PCR. Tenemos que diseñar unos primers. Normalmente los primers tienen una longitud de entre 15 y 20 nucleótidos. Nosotros para este ejercicio vamos a utilizar unos primers de 5 nucleótidos.

Tenemos el ADN

5' ACCTAGCCTTTCCAAATGCGCATTACAATATATAA 3'
3' TGGATCGGAAAGGTTTACGCGTAATGTTATATATT 5'

y vemos claramente nuestro gen

5' ACCTAGCCTTTCCAAATGCGCATTACAATATATAA 3'
3' TGGATCGGAAAGGTTTACGCGTAATGTTATATATT 5'

Eliminamos la parte del ADN que no nos interesa para que nos sea más fácil trabajar
 
5'  CTAGCCTTTCC AAATGCGCAT 3'
3' GATCGGAAAGGTTTACGCGTA 5'


La primera reacción de la PCR es la desnaturalización que ocurre a 94ºC durante un minuto. Esta reacción separa las dos hebras de ADN

5'  CTAGCCTTTCC AAATGCGCAT 3'


3' GATCGGAAAGGTTTACGCGTA 5'

La segunda reacción es la hibridación, a 65ºC durante 30 segundos, con los primers que tenemos habremos diseñado previamente. Los primers si son de 5 nucleótidos tienen que ser así

                                         3'GCGTA5'
5'  CTAGCCTTTCC AAATGCGCAT  3'

3' GATCGGAAAGGTTTACGCGTA 5'
 5'CTAGC3' 

Ahora viene la tercera reacción de la PCR, la elongación, llevada a cabo por la TaqPolimerasa a 72ºC durante 1 minuto.

3' GATCGGAAAGGTTTACGCGTA 5'
5' CTAGCCTTTCC AAATGCGCAT 3'


3' GATCGGAAAGGTTTACGCGTA 5'
5' CTAGCCTTTCC AAATGCGCAT 3'

Hemos pasado de un gen
 
5'  CTAGCCTTTCC AAATGCGCAT 3'
3' GATCGGAAAGGTTTACGCGTA 5'
a dos genes

3' GATCGGAAAGGTTTACGCGTA 5'
5' CTAGCCTTTCC AAATGCGCAT 3'


3' GATCGGAAAGGTTTACGCGTA 5'
5' CTAGCCTTTCC AAATGCGCAT 3'

Con una sola reacción de PCR que ha llevado 2 minutos 30 segundos. Hemos pasado de un gen a dos genes en la siguiente reacción tendremos 4, luego 8, 16, 32, 64, 128, 256, 512, 1024...

En 25 ciclos pasaremos de 1 gen a 33 millones de genes.

Aquí os dejo otro ejercicio resuelto:
Ejercicio PCR (4 puntos)


5’ TATATTATTATTTGTCCGACGTAACCCTTGTCAGGTTCGCCATGCGCGATGGCG 3'
3’ ATATAATAATAAACAGGCTGCATTGGGAACAGTCCAAGCGGTACGCGCTACCGC 5’

a) (1 puntos) Identifica el ORF en esta secuencia de ADN (Codon de inicio y codon de stop)

3’ ATATAATAAT/AAA/CAG/GCT/GCA/TTG/GGA/ACA/GTC/CAA/GCG/GTACGCGCTACCGC 5’  

              3' AAT/AAA/CAG/GCT/GCA/TTG/GGA/ACA/GTC/CAA/GCG/GTA  5' 
 
b) (0,5 puntos) ¿Cuántos nucleótidos codificantes tiene este gen? 

33 nucleótidos codificantes (36 nucleótidos totales)

c) (0,5 puntos) ¿Cuántos aminoácidos tendrá la proteína codificada en este gen?

11 aminoácidos 
c) (2 puntos) Amplifica el gen utilizando dos primers de 6 nucleótidos cada uno. Escribe los dos primers empleados para amplificar el gen estructural (desde el codon de inicio hasta el codon de stop)

5’ TATATTATTATTTGTCCGACGTAACCCTTGTCAGGTTCGCCATGCGCGATGGCG 3'
3’ ATATAATAATAAACAGGCTGCATTGGGAACAGTCCAAGCGGTACGCGCTACCGC 5’  

Eliminamos lo que sobra

5’ TTATTTGTCCGACGTAACCCTTGTCAGGTTCGCCAT 3'
3’ AATAAACAGGCTGCATTGGGAACAGTCCAAGCGGTA 5’

Desnaturalizamos
                                                         3'GCGGTA5'
5’ TTATTTGTCCGACGTAACCCTTGTCAGGTTCGCCAT 3'


3’ AATAAACAGGCTGCATTGGGAACAGTCCAAGCGGTA 5’
 5'TTATTT3'

Primer A: 5' ATGGCG 3' 
 
Primer B: 5' TTATTT 3'

PREGUNTA: Una molécula sencilla de ADN se amplifica por PCR durante 25 ciclos. Teóricamente, ¿Cuántas moléculas de ADN amplificadas producirá? Si en vez de 1 molécula empezamos por 600 moléculas ¿Cuántas moléculas de ADN amplificadas producirá?
Mis alumnos, unos auténticos cracks, resolviendo en grupo un ejercicio de digestión enzimática del ADN
Aprender a leer es una emoción enorme. Salir a la calle y poder leer los carteles. Trato de que los alumnos sean conscientes de que van a poder leer el código de la vida.

Es importante cuando se empieza en un nuevo lenguaje seguir unas reglas. ¿Os acordáis de los punteados? Para trabajar en genética hay que seguir también unas reglas. Y yo que soy profe también soy estudiante. En estos momentos "mi mamá me mima" particular es esto.

jueves, 10 de noviembre de 2016

Propiedades químicas y fonéticas

El código genético se traduce a un código de aminoácidos. Los aminoácidos son los componentes de las proteínas. El código sólo es información, software, mientras que las proteínas son el hardware, los componentes de las máquinas que hacen funcionar la vida. En las proteínas de los seres vivos hay 20 aminoácidos
Los ordenadores tienen un código basado en ceros y unos, apagado y encendido. Las 27 letras del alfabeto latino tienen su correspondencia en ceros y unos que en combinaciones de 8, los bytes, que permiten codificar esas 27 letras. Las letras tienen distintas propiedades fonéticas, lo mismo que los aminoácidos tienen distintas propiedades químicas.