jueves, 17 de noviembre de 2016

Ejercicio amplifica el gen



5' ACCTAGCCTTTCCAAATGCGCATTACAATATATAA 3'

1- Encuentra el gen en este fragmento de ADN. ATG comienzo y stop TAA; TAG o TGA.
2.- Tamaño del gen en nt (el stop cuenta)
3.- Tamaño en aminoácidos de la proteína codificada
4.- Diseña dos primers de 5 nt para amplificar por PCR este gen.

Solución: Una secuencia genética se escribe usualmente utilizando una de las dos hebras de ADN. La razón, ahorrar espacio, como la información de la otra hebra se extrae automáticamente porque es complementaria por ese motivo no se suele representar. Para hacer un ejercicio de PCR necesitamos escribirla.

5' ACCTAGCCTTTCCAAATGCGCATTACAATATATAA 3'
3' TGGATCGGAAAGGTTTACGCGTAATGTTATATATT 5' 

Ahora tenemos que buscar un ORF (Open reading frame en inglés) el ORF es la información del gen que se va a traducir a proteína. El ORF consta de un ATG, que es el inicio, lo mismo que en castellano sería la primera letra, siempre en mayúscula, de una frase, y un stop, que sería el punto al final de la frase si en vez de código genético estuviésemos trabajando con frases en castellano.


5' ACCTAGCCTTTCCAAATG/CGC/ATT/ACA/ATA/TAT/AA 3'

Primero situamos el ATG y de 5' a 3' empezamos a buscar triplete a triplete un stop. ¿No hay stop? entonces no hay un ORF en la hebra de arriba. Vamos a buscarla en la de abajo.

En la hebra de abajo tenemos que leer de 5' a 3' también, pero OJO hay que leer como los árabes, de derecha a izquierda

3' TGGAT/CGG/AAA/GGT/TTA/CGC/GTAATGTTATATATT 5'

En la hebra de abajo tenemos un ORF. Se trata de un gen (tamaño escolar, en la realidad los genes suelen ser mucho más grandes) de 21 nucleótidos que codifica para una proteína de 6 aminoácidos.

Ahora vamos a amplificar este gen mediante PCR. Tenemos que diseñar unos primers. Normalmente los primers tienen una longitud de entre 15 y 20 nucleótidos. Nosotros para este ejercicio vamos a utilizar unos primers de 5 nucleótidos.

Tenemos el ADN

5' ACCTAGCCTTTCCAAATGCGCATTACAATATATAA 3'
3' TGGATCGGAAAGGTTTACGCGTAATGTTATATATT 5'

y vemos claramente nuestro gen

5' ACCTAGCCTTTCCAAATGCGCATTACAATATATAA 3'
3' TGGATCGGAAAGGTTTACGCGTAATGTTATATATT 5'

Eliminamos la parte del ADN que no nos interesa para que nos sea más fácil trabajar
 
5'  CTAGCCTTTCC AAATGCGCAT 3'
3' GATCGGAAAGGTTTACGCGTA 5'


La primera reacción de la PCR es la desnaturalización que ocurre a 94ºC durante un minuto. Esta reacción separa las dos hebras de ADN

5'  CTAGCCTTTCC AAATGCGCAT 3'


3' GATCGGAAAGGTTTACGCGTA 5'

La segunda reacción es la hibridación, a 65ºC durante 30 segundos, con los primers que tenemos habremos diseñado previamente. Los primers si son de 5 nucleótidos tienen que ser así

                                         3'GCGTA5'
5'  CTAGCCTTTCC AAATGCGCAT  3'

3' GATCGGAAAGGTTTACGCGTA 5'
 5'CTAGC3' 

Ahora viene la tercera reacción de la PCR, la elongación, llevada a cabo por la TaqPolimerasa a 72ºC durante 1 minuto.

3' GATCGGAAAGGTTTACGCGTA 5'
5' CTAGCCTTTCC AAATGCGCAT 3'


3' GATCGGAAAGGTTTACGCGTA 5'
5' CTAGCCTTTCC AAATGCGCAT 3'

Hemos pasado de un gen
 
5'  CTAGCCTTTCC AAATGCGCAT 3'
3' GATCGGAAAGGTTTACGCGTA 5'
a dos genes

3' GATCGGAAAGGTTTACGCGTA 5'
5' CTAGCCTTTCC AAATGCGCAT 3'


3' GATCGGAAAGGTTTACGCGTA 5'
5' CTAGCCTTTCC AAATGCGCAT 3'

Con una sola reacción de PCR que ha llevado 2 minutos 30 segundos. Hemos pasado de un gen a dos genes en la siguiente reacción tendremos 4, luego 8, 16, 32, 64, 128, 256, 512, 1024...

En 25 ciclos pasaremos de 1 gen a 33 millones de genes.

Aquí os dejo otro ejercicio resuelto:
Ejercicio PCR (4 puntos)

5’ TATATTATTATTTGTCCGACGTAACCCTTGTCAGGTTCGCCATGCGCGATGGCG 3'
3’ ATATAATAATAAACAGGCTGCATTGGGAACAGTCCAAGCGGTACGCGCTACCGC 5’

a) (1 puntos) Identifica el ORF en esta secuencia de ADN (Codon de inicio y codon de stop)

3’ ATATAATAAT/AAA/CAG/GCT/GCA/TTG/GGA/ACA/GTC/CAA/GCG/GTACGCGCTACCGC 5’  

              3' AAT/AAA/CAG/GCT/GCA/TTG/GGA/ACA/GTC/CAA/GCG/GTA  5' 
 
b) (0,5 puntos) ¿Cuántos nucleótidos codificantes tiene este gen? 

33 nucleótidos codificantes (36 nucleótidos totales)

c) (0,5 puntos) ¿Cuántos aminoácidos tendrá la proteína codificada en este gen?

11 aminoácidos 
c) (2 puntos) Amplifica el gen utilizando dos primers de 6 nucleótidos cada uno. Escribe los dos primers empleados para amplificar el gen estructural (desde el codon de inicio hasta el codon de stop)

5’ TATATTATTATTTGTCCGACGTAACCCTTGTCAGGTTCGCCATGCGCGATGGCG 3'
3’ ATATAATAATAAACAGGCTGCATTGGGAACAGTCCAAGCGGTACGCGCTACCGC 5’  

Eliminamos lo que sobra

5’ TTATTTGTCCGACGTAACCCTTGTCAGGTTCGCCAT 3'
3’ AATAAACAGGCTGCATTGGGAACAGTCCAAGCGGTA 5’

Desnaturalizamos
                                                         3'GCGGTA5'
5’ TTATTTGTCCGACGTAACCCTTGTCAGGTTCGCCAT 3'


3’ AATAAACAGGCTGCATTGGGAACAGTCCAAGCGGTA 5’
 5'TTATTT3'

Primer A: 5' ATGGCG 3' 
 
Primer B: 5' TTATTT 3'
Mis alumnos, unos auténticos cracks, resolviendo en grupo un ejercicio de digestión enzimática del ADN
Aprender a leer es una emoción enorme. Salir a la calle y poder leer los carteles. Trato de que los alumnos sean conscientes de que van a poder leer el código de la vida.

Es importante cuando se empieza en un nuevo lenguaje seguir unas reglas. ¿Os acordáis de los punteados? Para trabajar en genética hay que seguir también unas reglas. Y yo que soy profe también soy estudiante. En estos momentos "mi mamá me mima" particular es esto.

No hay comentarios:

Publicar un comentario